FORGEdb Summary for
Summary and number of annotations for rs12203592 (FORGEdb score=10)UCSC genome browser link (hg19)
| RefSeq closest gene data | 1 |
|---|---|
| CADD v1.6 annotations | 3 |
| GTEx cis-eQTLs | 13 |
| eQTLGen blood cis-eQTLs | 2 |
| ABC contacts | 1 |
| FORGE2-TF motifs | 1 |
| CATO score | 1 |
| Zoonomia conservation information: Human PhyloP score V2 | 1 |
| FORGE2 blueprint DNase I hotspots (blueprint) | 1 |
| FORGE2 ENCODE DNase I hotspots (encode) | 18 |
| FORGE2 unconsolidated roadmap DNase I hotspots (erc) | 13 |
| FORGE2 consolidated roadmap chromatin states (erc2-chromatin15state-all) | 127 |
| FORGE2 consolidated roadmap DNase I hotspots (erc2-DHS) | 1 |
| FORGE2 consolidated roadmap H3 histone marks (erc2-H3-all) | 59 |
| ENCODE4 CRISPR sgRNAs | 11 |
RefSeq closest gene information (hg19, for more details, see NCBI RefSeq)
| RSID | SNP Chromosome | SNP Start Position | SNP End Position | Gene Chromosome | Gene Start Position | Gene End Position | Gene Symbol |
|---|---|---|---|---|---|---|---|
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 393151 | 407598 | IRF4 |
CADD v1.6 annotations at SNP coordinates in hg19 (note that none or several variants may be shown at this position)
| SNP Chromosome | SNP Position | Reference Allele | Alternative Allele | Raw CADD Score | Phred Score |
|---|---|---|---|---|---|
| chr6 | 396321 | C | A | 0.639586 | 10.65 |
| chr6 | 396321 | C | G | 0.629036 | 10.56 |
| chr6 | 396321 | C | T | 0.687756 | 11.05 |
GTEx cis-eQTL information (for more details, see https://gtexportal.org/home/)
| RSID | Gene Symbol | Ensembl Gene ID | Ensembl Gene ID 2 | TSS Distance | Reference Allele | Alternative Allele | Num. Alternative Alleles Per Site | MA Samples | MA Count | MAF | Slope | Slope SE | P-value Nominal | P-value Nominal Threshold | Min P-value Nominal | P-value Beta | Biosample | Variant Chromosome (hg38) | Variant Position (hg38) | Variant ID (b37) | Variant ID (b38) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 127 | 134 | 0.142857 | 0.314227 | 0.066502 | 3.193e-06 | 7.71521e-05 | 3.193e-06 | 0.00968924 | Adipose_Visceral_Omentum.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 131 | 141 | 0.136893 | 0.340785 | 0.0441764 | 8.06271e-14 | 0.000101464 | 8.06271e-14 | 7.24627e-10 | Lung.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 131 | 146 | 0.146881 | 0.199096 | 0.0418823 | 2.73449e-06 | 0.000130119 | 2.73449e-06 | 0.00822666 | Esophagus_Mucosa.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 137 | 147 | 0.138158 | 0.30964 | 0.0636546 | 1.57732e-06 | 0.000158308 | 1.57732e-06 | 0.00499376 | Nerve_Tibial.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 153 | 164 | 0.135537 | -0.317935 | 0.059111 | 1.12372e-07 | 0.000185481 | 1.12372e-07 | 0.000437614 | Skin_Sun_Exposed_Lower_leg.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 158 | 168 | 0.146341 | 0.194124 | 0.0461795 | 3.10733e-05 | 0.000168976 | 1.8843e-05 | 0.0498733 | Thyroid.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 175 | 191 | 0.142537 | 0.224244 | 0.0312332 | 2.07501e-12 | 0.000113586 | 2.07501e-12 | 1.88627e-08 | Whole_Blood.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 45 | 49 | 0.166667 | 0.535119 | 0.113433 | 6.41646e-06 | 1.98886e-05 | 6.41646e-06 | 0.0144505 | Cells_EBV-transformed_lymphocytes.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 49 | 52 | 0.149425 | 0.268423 | 0.0530374 | 1.34842e-06 | 3.63e-05 | 1.34842e-06 | 0.00385771 | Small_Intestine_Terminal_Ileum.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 62 | 68 | 0.14978 | 0.328192 | 0.0483426 | 1.45361e-10 | 6.63642e-05 | 1.45361e-10 | 5.70975e-07 | Spleen.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 86 | 94 | 0.145963 | 0.355587 | 0.0623373 | 3.09584e-08 | 0.000103226 | 3.09584e-08 | 0.000108234 | Testis.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 91 | 97 | 0.149691 | 0.171746 | 0.0395006 | 1.95155e-05 | 4.80885e-05 | 4.93613e-06 | 0.0129741 | Stomach.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
| rs12203592 | IRF4 | ENSG00000137265 | ENSG00000137265.14 | 4582 | C | T | 1 | 97 | 105 | 0.142663 | 0.180132 | 0.0398997 | 9.14525e-06 | 6.12538e-05 | 1.94201e-06 | 0.00587648 | Colon_Transverse.v8.signif_variant_gene_pairs.txt | chr6 | 396321 | chr6_396321_C_T_b37 | chr6_396321_C_T_b38 |
eQTLGen blood FDR 0.05 cis-eQTL information (hg19, for more details, see https://www.eqtlgen.org)
| RSID | SNP Chromosome | SNP Position | Ensembl Gene ID | Gene Symbol | Gene Chromosome | Gene Position | P-value | Assessed Allele | Other Allele | Z-score | Number of Cohorts | Number of Samples | Tissue | FDR | Bonferroni P-value |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| rs12203592 | chr6 | 396321 | ENSG00000137265 | IRF4 | chr6 | 401593 | 1.4771E-29 | T | C | 11.2896 | 33 | 30912 | Blood | 0.0 | 1.8810E-21 |
| rs12203592 | chr6 | 396321 | ENSG00000112685 | EXOC2 | chr6 | 589125 | 6.4207E-11 | T | C | -6.5335 | 33 | 30912 | Blood | 0.0 | 0.008176234824186 |
Activity-By-Contact (ABC) information (hg19, for more details, see https://www.engreitzlab.org/resources)
| RSID | SNP Chromosome | SNP Start Position | SNP End Position | Bait Chromosome | Bait Start Position | Bait End Position | Name | Class | Activity Base | Target Gene | Target Gene TSS | Target Gene Expression | Target Gene Promoter Activity Quantile | Target Gene Is Expressed? | Distance | Is Self Promoter? | Powerlaw Contact | Powerlaw Contact Reference | Hi-C Contact | Hi-C Contact PL Scaled | Hi-C Contact PL Scaled Adj. | Hi-C Pseudocount | ABC Score Numerator | ABC Score | Powerlaw Score Numerator | Powerlaw Score | Cell Type | Base Overlap |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396175 | 396375 | genic|chr6:396025-396525 | genic | 3.644273 | IRF4 | 391738 | NA | 0.815667 | True | 4537 | False | 0.125372 | 0.123436 | 0.04777 | 0.047032 | 0.048248 | 0.001216 | 0.175829 | 0.03375 | 0.449835 | 0.040169 | MM.1S-ENCODE | 1 |
FORGE2-TF motif information (hg19, for more details, see FORGE2-TF, eFORGE-TF and the FORGE2 main paper)
| RSID | SNP Chromosome | SNP Start Position | SNP End Position | TF Motif Chromosome | TF Motif Start Position | TF Motif End Position | TF Motif Name | P-value | Strand | Genomic Sequence |
|---|---|---|---|---|---|---|---|---|---|---|
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396315 | 396330 | V_TST1_01 | 8.19273e-06 | - | GAAGGCAAATTCCCC |
CATO (contextual analysis of TF occupancy) score (coordinates in hg19, for more details, see http://www.mauranolab.org/CATO/)
| RSID | SNP Chromosome | SNP Start Position | SNP End Position | CATO score | Strand | TF Motif | Score 1 | Score 2 | Allele 1 | Allele 2 | Biosample |
|---|---|---|---|---|---|---|---|---|---|---|---|
| rs12203592 | chr6 | 396320 | 396321 | 0.0542 | - | V_NFKAPPAB65_01 | 9 | 4 | C | T | CD19;CD20;CD3;CD34;CD3_CordBlood;CD4;CD4pos_N;CD56;CMK;GM12864;GM12865;GM12878;Gastric_Mucosa;K562;PANC1;Skin_Melanocytes;Trophoblast;fKidney;fMuscle;hTH1;hTH17;hTH2;hTR;iTH1;vHMEC |
Zoonomia conservation information: Human PhyloP score V2 (hg38, from the 241-way mammalian alignment, for more details, see https://cglgenomics.ucsc.edu/data/cactus/)
| RSID | SNP Chromosome | SNP Start Position | SNP End Position | PhyloP Chromosome | PhyloP Start Position | PhyloP End Position | Zoonomia PhyloP Score |
|---|---|---|---|---|---|---|---|
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396320 | 396321 | 1.274 |
FORGE2 blueprint DNase I hotspots (blueprint)
| Cell | Tissue | Datatype | RSID |
|---|---|---|---|
| macrophage_-_T_6days_untreated | Venous Blood | DNase I Hotspot | rs12203592 |
FORGE2 ENCODE DNase I hotspots (encode)
| Cell | Tissue | Datatype | RSID |
|---|---|---|---|
| Adult_CD4+ | Blood | DNase I hotspot | rs12203592 |
| CD20+ | Blood | DNase I hotspot | rs12203592 |
| CMK | Blood | DNase I hotspot | rs12203592 |
| GM12864 | Blood | DNase I hotspot | rs12203592 |
| GM12865 | Blood | DNase I hotspot | rs12203592 |
| GM12878 | Blood | DNase I hotspot | rs12203592 |
| Osteobl | Bone | DNase I hotspot | rs12203592 |
| Medullo | Brain | DNase I hotspot | rs12203592 |
| MCF-7 | Breast | DNase I hotspot | rs12203592 |
| 8988T | Liver | DNase I hotspot | rs12203592 |
| Hepatocytes | Liver | DNase I hotspot | rs12203592 |
| Huh-7.5 | Liver | DNase I hotspot | rs12203592 |
| Myometr | Myometrium | DNase I hotspot | rs12203592 |
| PANC-1 | Pancreas | DNase I hotspot | rs12203592 |
| PanIslets | Pancreas | DNase I hotspot | rs12203592 |
| HPDE6-E6E7 | Pancreatic duct | DNase I hotspot | rs12203592 |
| Melano | Skin | DNase I hotspot | rs12203592 |
| ProgFib | Skin | DNase I hotspot | rs12203592 |
FORGE2 unconsolidated roadmap DNase I hotspots (erc)
| Cell | Tissue | Datatype | RSID |
|---|---|---|---|
| CD3 | Blood | DNase I hotspot | rs12203592 |
| CD4 | Blood | DNase I hotspot | rs12203592 |
| CD4 | Blood | DNase I hotspot | rs12203592 |
| CD19 | Blood | DNase I hotspot | rs12203592 |
| CD19 | Blood | DNase I hotspot | rs12203592 |
| CD34_Mobilised; | Blood | DNase I hotspot | rs12203592 |
| CD34_Mobilised; | Blood | DNase I hotspot | rs12203592 |
| CD56_Mobilised; | Blood | DNase I hotspot | rs12203592 |
| Fetal_Kidney | Fetal Kidney | DNase I hotspot | rs12203592 |
| Fetal_Muscle_Arm | Fetal Muscle | DNase I hotspot | rs12203592 |
| Fetal_Muscle_Back | Fetal Muscle | DNase I hotspot | rs12203592 |
| Penis_Foreskin_Melanocyte | Skin | DNase I hotspot | rs12203592 |
| Penis_Foreskin_Melanocyte | Skin | DNase I hotspot | rs12203592 |
FORGE2 consolidated roadmap chromatin states (erc2-chromatin15state-all)
| Cell | Tissue | Datatype | RSID |
|---|---|---|---|
| E063 Adipose Nuclei | Adipose | TxWk | rs12203592 |
| E080 Fetal Adrenal Gland | Adrenal | ReprPC | rs12203592 |
| E029 Primary monocytes from peripheral blood | Blood | ReprPC | rs12203592 |
| E030 Primary neutrophils from peripheral blood | Blood | ReprPC | rs12203592 |
| E031 Primary B cells from cord blood | Blood | Tx | rs12203592 |
| E032 Primary B cells from peripheral blood | Blood | EnhG | rs12203592 |
| E033 Primary T cells from cord blood | Blood | Tx | rs12203592 |
| E034 Primary T cells from peripheral blood | Blood | Tx | rs12203592 |
| E035 Primary hematopoietic stem cells | Blood | ReprPCWk | rs12203592 |
| E036 Primary hematopoietic stem cells short term culture | Blood | ReprPC | rs12203592 |
| E037 Primary T helper memory cells from peripheral blood 2 | Blood | TxWk | rs12203592 |
| E038 Primary T helper naive cells from peripheral blood | Blood | TxWk | rs12203592 |
| E039 Primary T helper naive cells from peripheral blood | Blood | TxWk | rs12203592 |
| E040 Primary T helper memory cells from peripheral blood 1 | Blood | ReprPCWk | rs12203592 |
| E041 Primary T helper cells PMA-I stimulated | Blood | TxFlnk | rs12203592 |
| E042 Primary T helper 17 cells PMA-I stimulated | Blood | TxFlnk | rs12203592 |
| E043 Primary T helper cells from peripheral blood | Blood | TxWk | rs12203592 |
| E044 Primary T regulatory cells from peripheral blood | Blood | EnhG | rs12203592 |
| E045 Primary T cells effector/memory enriched from peripheral blood | Blood | TxWk | rs12203592 |
| E046 Primary Natural Killer cells from peripheral blood | Blood | TxWk | rs12203592 |
| E047 Primary T CD8+ naive cells from peripheral blood | Blood | TxWk | rs12203592 |
| E048 Primary T CD8+ memory cells from peripheral blood | Blood | TxWk | rs12203592 |
| E050 Primary hematopoietic stem cells G-CSF-mobilized Female | Blood | ReprPC | rs12203592 |
| E051 Primary hematopoietic stem cells G-CSF-mobilized Male | Blood | ReprPC | rs12203592 |
| E062 Primary mononuclear cells from peripheral blood | Blood | Tx | rs12203592 |
| E115 Dnd41 TCell Leukemia | Blood | ReprPCWk | rs12203592 |
| E116 GM12878 Lymphoblastoid | Blood | TxFlnk | rs12203592 |
| E123 K562 Leukemia | Blood | ReprPCWk | rs12203592 |
| E124 Monocytes-CD14+ RO01746 Primary Cells | Blood | ReprPC | rs12203592 |
| E129 Osteoblast Primary Cells | Bone | ReprPC | rs12203592 |
| E067 Brain Angular Gyrus | Brain | ReprPCWk | rs12203592 |
| E068 Brain Anterior Caudate | Brain | ReprPCWk | rs12203592 |
| E069 Brain Cingulate Gyrus | Brain | ReprPCWk | rs12203592 |
| E070 Brain Germinal Matrix | Brain | ReprPC | rs12203592 |
| E071 Brain Hippocampus Middle | Brain | ReprPC | rs12203592 |
| E072 Brain Inferior Temporal Lobe | Brain | ReprPCWk | rs12203592 |
| E073 Brain_Dorsolateral_Prefrontal_Cortex | Brain | ReprPCWk | rs12203592 |
| E074 Brain Substantia Nigra | Brain | ReprPCWk | rs12203592 |
| E081 Fetal Brain Male | Brain | ReprPC | rs12203592 |
| E082 Fetal Brain Female | Brain | ReprPC | rs12203592 |
| E125 NH-A Astrocytes Primary Cells | Brain | ReprPC | rs12203592 |
| E119 HMEC Mammary Epithelial Primary Cells | Breast | ReprPC | rs12203592 |
| E117 HeLa-S3 Cervical Carcinoma | Cervix | ReprPC | rs12203592 |
| E075 Colonic Mucosa | Digestive | ReprPCWk | rs12203592 |
| E077 Duodenum Mucosa | Digestive | ReprPCWk | rs12203592 |
| E079 Esophagus | Digestive | TxWk | rs12203592 |
| E084 Fetal Intestine Large | Digestive | ReprPC | rs12203592 |
| E085 Fetal Intestine Small | Digestive | ReprPC | rs12203592 |
| E092 Fetal Stomach | Digestive | ReprPC | rs12203592 |
| E094 Gastric | Digestive | ReprPCWk | rs12203592 |
| E101 Rectal Mucosa Donor 29 | Digestive | TxWk | rs12203592 |
| E102 Rectal Mucosa Donor 31 | Digestive | ReprPCWk | rs12203592 |
| E106 Sigmoid Colon | Digestive | TxWk | rs12203592 |
| E109 Small Intestine | Digestive | ReprPCWk | rs12203592 |
| E110 Stomach Mucosa | Digestive | ReprPC | rs12203592 |
| E122 HUVEC Umbilical Vein Endothelial Primary Cells | Endothelial | ReprPCWk | rs12203592 |
| E027 Breast Myoepithelial Primary Cells | Epithelial | ReprPC | rs12203592 |
| E028 Breast variant Human Mammary Epithelial Cells (vHMEC) | Epithelial | ReprPC | rs12203592 |
| E055 Foreskin Fibroblast Primary Cells skin01 | Epithelial | ReprPC | rs12203592 |
| E056 Foreskin Fibroblast Primary Cells skin02 | Epithelial | ReprPC | rs12203592 |
| E057 Foreskin Keratinocyte Primary Cells skin02 | Epithelial | ReprPCWk | rs12203592 |
| E058 Foreskin Keratinocyte Primary Cells skin03 | Epithelial | ReprPC | rs12203592 |
| E059 Foreskin Melanocyte Primary Cells skin01 | Epithelial | TxFlnk | rs12203592 |
| E061 Foreskin Melanocyte Primary Cells skin03 | Epithelial | TssAFlnk | rs12203592 |
| E126 NHDF-Ad Adult Dermal Fibroblast Primary Cells | Epithelial | ReprPC | rs12203592 |
| E127 NHEK-Epidermal Keratinocyte Primary Cells | Epithelial | ReprPC | rs12203592 |
| E001 ES-I3 | ESC | ReprPCWk | rs12203592 |
| E002 ES-WA7 | ESC | ReprPCWk | rs12203592 |
| E003 H1 | ESC | ReprPCWk | rs12203592 |
| E008 H9 | ESC | ReprPCWk | rs12203592 |
| E014 HUES48 | ESC | ReprPC | rs12203592 |
| E015 HUES6 | ESC | ReprPC | rs12203592 |
| E016 HUES64 | ESC | ReprPC | rs12203592 |
| E024 ES-UCSF4 | ESC | ReprPCWk | rs12203592 |
| E004 H1 BMP4 Derived Mesendoderm Cultured | ES-derived | ReprPCWk | rs12203592 |
| E005 H1 BMP4 Derived Trophoblast Cultured | ES-derived | ReprPCWk | rs12203592 |
| E006 H1 Derived Mesenchymal Stem Cells | ES-derived | ReprPC | rs12203592 |
| E007 H1 Derived Neuronal Progenitor Cultured | ES-derived | ReprPCWk | rs12203592 |
| E009 H9 Derived Neuronal Progenitor Cultured | ES-derived | ReprPC | rs12203592 |
| E010 H9 Derived Neuron Cultured | ES-derived | ReprPC | rs12203592 |
| E011 hESC Derived CD184+ Endoderm Cultured | ES-derived | ReprPC | rs12203592 |
| E012 hESC Derived CD56+ Ectoderm Cultured | ES-derived | ReprPC | rs12203592 |
| E013 hESC Derived CD56+ Mesoderm Cultured | ES-derived | ReprPCWk | rs12203592 |
| E065 Aorta | Heart | Het | rs12203592 |
| E083 Fetal Heart | Heart | ReprPC | rs12203592 |
| E095 Left Ventricle | Heart | ReprPC | rs12203592 |
| E104 Right Atrium | Heart | TxWk | rs12203592 |
| E105 Right Ventricle | Heart | ReprPCWk | rs12203592 |
| E018 iPS-15b | iPSC | ReprPC | rs12203592 |
| E019 iPS-18 | iPSC | ReprPC | rs12203592 |
| E020 iPS-20b | iPSC | ReprPC | rs12203592 |
| E021 iPS DF 6.9 | iPSC | ReprPCWk | rs12203592 |
| E022 iPS DF 19.11 | iPSC | TxWk | rs12203592 |
| E086 Fetal Kidney | Kidney | ReprPC | rs12203592 |
| E066 Liver | Liver | ReprPCWk | rs12203592 |
| E118 HepG2 Hepatocellular Carcinoma | Liver | ReprPC | rs12203592 |
| E017 IMR90 fetal lung fibroblasts | Lung | ReprPC | rs12203592 |
| E088 Fetal Lung | Lung | ReprPC | rs12203592 |
| E096 Lung | Lung | Het | rs12203592 |
| E114 A549 EtOH 0.02pct Lung Carcinoma | Lung | ReprPC | rs12203592 |
| E128 NHLF Lung Fibroblast Primary Cells | Lung | ReprPC | rs12203592 |
| E023 Mesenchymal Stem Cell Derived Adipocyte Cultured | Mesenchymal | ReprPC | rs12203592 |
| E025 Adipose Derived Mesenchymal Stem Cell Cultured | Mesenchymal | ReprPC | rs12203592 |
| E026 Bone Marrow Derived Cultured Mesenchymal Stem Cells | Mesenchymal | ReprPC | rs12203592 |
| E049 Mesenchymal Stem Cell Derived Chondrocyte Cultured | Mesenchymal | ReprPC | rs12203592 |
| E052 Muscle Satellite Cultured | Muscle | ReprPC | rs12203592 |
| E089 Fetal Muscle Trunk | Muscle | ReprPC | rs12203592 |
| E090 Fetal Muscle Leg | Muscle | ReprPC | rs12203592 |
| E100 Psoas Muscle | Muscle | ReprPCWk | rs12203592 |
| E107 Skeletal Muscle Male | Muscle | ReprPC | rs12203592 |
| E108 Skeletal Muscle Female | Muscle | ReprPC | rs12203592 |
| E120 HSMM Skeletal Muscle Myoblasts | Muscle | ReprPC | rs12203592 |
| E121 HSMM cell derived Skeletal Muscle Myotubes | Muscle | ReprPC | rs12203592 |
| E053 Cortex derived primary cultured neurospheres | Neurosphere | ReprPC | rs12203592 |
| E054 Ganglion Eminence derived primary cultured neurospheres | Neurosphere | ReprPC | rs12203592 |
| E097 Ovary | Ovary | ReprPCWk | rs12203592 |
| E087 Pancreatic Islets | Pancreas | ReprPCWk | rs12203592 |
| E098 Pancreas | Pancreas | Quies | rs12203592 |
| E091 Placenta | Placenta | ReprPCWk | rs12203592 |
| E099 Placenta Amnion | Placenta | Enh | rs12203592 |
| E076 Colon Smooth Muscle | Smooth Muscle | ReprPCWk | rs12203592 |
| E078 Duodenum Smooth Muscle | Smooth Muscle | ReprPC | rs12203592 |
| E103 Rectal Smooth Muscle | Smooth Muscle | ReprPCWk | rs12203592 |
| E111 Stomach Smooth Muscle | Smooth Muscle | ReprPC | rs12203592 |
| E113 Spleen | Spleen | TxWk | rs12203592 |
| E093 Fetal Thymus | Thymus | ReprPC | rs12203592 |
| E112 Thymus | Thymus | ReprPC | rs12203592 |
FORGE2 consolidated roadmap DNase I hotspots (erc2-DHS)
| Cell | Tissue | Datatype | RSID |
|---|---|---|---|
| E059 Foreskin Melanocyte Primary Cells skin01 | Skin | DNase I hotspot | rs12203592 |
FORGE2 consolidated roadmap H3 histone marks (erc2-H3-all)
| Cell | Tissue | Datatype | RSID |
|---|---|---|---|
| E029 Primary monocytes from peripheral blood | Blood | H3K27me3 | rs12203592 |
| E029 Primary monocytes from peripheral blood | Blood | H3K36me3 | rs12203592 |
| E032 Primary B cells from peripheral blood | Blood | H3K4me1 | rs12203592 |
| E032 Primary B cells from peripheral blood | Blood | H3K36me3 | rs12203592 |
| E033 Primary T cells from cord blood | Blood | H3K36me3 | rs12203592 |
| E034 Primary T cells from peripheral blood | Blood | H3K4me1 | rs12203592 |
| E034 Primary T cells from peripheral blood | Blood | H3K36me3 | rs12203592 |
| E046 Primary Natural Killer cells from peripheral | Blood | H3K36me3 | rs12203592 |
| E050 Primary hematopoietic stem cells G-CSF-mobili | Blood | H3K9me3 | rs12203592 |
| E050 Primary hematopoietic stem cells G-CSF-mobili | Blood | H3K27me3 | rs12203592 |
| E051 Primary hematopoietic stem cells G-CSF-mobili | Blood | H3K27me3 | rs12203592 |
| E028 Breast variant Human Mammary Epithelial Cells | Breast | H3K27me3 | rs12203592 |
| E003 H1 Cells | ES Cell | H3K9me3 | rs12203592 |
| E004 H1 BMP4 Derived Mesendoderm Cultured Cells | ES Cell | H3K27me3 | rs12203592 |
| E005 H1 BMP4 Derived Trophoblast Cultured Cells | ES Cell | H3K4me1 | rs12203592 |
| E005 H1 BMP4 Derived Trophoblast Cultured Cells | ES Cell | H3K27me3 | rs12203592 |
| E006 H1 Derived Mesenchymal Stem Cells | ES Cell | H3K9me3 | rs12203592 |
| E006 H1 Derived Mesenchymal Stem Cells | ES Cell | H3K27me3 | rs12203592 |
| E007 H1 Derived Neuronal Progenitor Cultured Cells | ES Cell | H3K4me1 | rs12203592 |
| E007 H1 Derived Neuronal Progenitor Cultured Cells | ES Cell | H3K27me3 | rs12203592 |
| E008 H9 Cells | ES Cell | H3K9me3 | rs12203592 |
| E008 H9 Cells | ES Cell | H3K27me3 | rs12203592 |
| E085 Fetal Intestine Small | Fetal Intestine Small | H3K27me3 | rs12203592 |
| E080 Fetal Adrenal Gland | Fetal Adrenal Gland | H3K27me3 | rs12203592 |
| E081 Fetal Brain Male | Fetal Brain | H3K27me3 | rs12203592 |
| E082 Fetal Brain Female | Fetal Brain | H3K27me3 | rs12203592 |
| E083 Fetal Heart | Fetal Heart | H3K9me3 | rs12203592 |
| E083 Fetal Heart | Fetal Heart | H3K27me3 | rs12203592 |
| E083 Fetal Heart | Fetal Heart | H3K36me3 | rs12203592 |
| E084 Fetal Intestine Large | Fetal Intestine Large | H3K27me3 | rs12203592 |
| E086 Fetal Kidney | Fetal Kidney | H3K27me3 | rs12203592 |
| E088 Fetal Lung | Fetal Lung | H3K4me1 | rs12203592 |
| E088 Fetal Lung | Fetal Lung | H3K27me3 | rs12203592 |
| E090 Fetal Muscle Leg | Fetal Muscle Leg | H3K27me3 | rs12203592 |
| E089 Fetal Muscle Trunk | Fetal Muscle Trunk | H3K27me3 | rs12203592 |
| E092 Fetal Stomach | Fetal Stomach | H3K27me3 | rs12203592 |
| E093 Fetal Thymus | Fetal Thymus | H3K27me3 | rs12203592 |
| E093 Fetal Thymus | Fetal Thymus | H3K36me3 | rs12203592 |
| E094 Gastric | Gastric | H3K4me1 | rs12203592 |
| E094 Gastric | Gastric | H3K9me3 | rs12203592 |
| E094 Gastric | Gastric | H3K27me3 | rs12203592 |
| E094 Gastric | Gastric | H3K36me3 | rs12203592 |
| E021 iPS DF 6.9 Cells | IPS cell | H3K27me3 | rs12203592 |
| E022 iPS DF 19.11 Cells | IPS cell | H3K27me3 | rs12203592 |
| E017 IMR90 fetal lung fibroblasts Cell Line | Lung | H3K27me3 | rs12203592 |
| E097 Ovary | Ovary | H3K27me3 | rs12203592 |
| E098 Pancreas | Pancreas | H3K4me1 | rs12203592 |
| E091 Placenta | Placenta | H3K27me3 | rs12203592 |
| E100 Psoas Muscle | Psoas Muscle | H3K27me3 | rs12203592 |
| E055 Foreskin Fibroblast Primary Cells skin01 | Skin | H3K27me3 | rs12203592 |
| E055 Foreskin Fibroblast Primary Cells skin01 | Skin | H3K36me3 | rs12203592 |
| E056 Foreskin Fibroblast Primary Cells skin02 | Skin | H3K27me3 | rs12203592 |
| E057 Foreskin Keratinocyte Primary Cells skin02 | Skin | H3K27me3 | rs12203592 |
| E059 Foreskin Melanocyte Primary Cells skin01 | Skin | H3K4me1 | rs12203592 |
| E059 Foreskin Melanocyte Primary Cells skin01 | Skin | H3K4me3 | rs12203592 |
| E059 Foreskin Melanocyte Primary Cells skin01 | Skin | H3K9me3 | rs12203592 |
| E059 Foreskin Melanocyte Primary Cells skin01 | Skin | H3K36me3 | rs12203592 |
| E109 Small Intestine | Small Intestine | H3K27me3 | rs12203592 |
| E109 Small Intestine | Small Intestine | H3K36me3 | rs12203592 |
CRISPR sgRNAs Targeting ENCODE4 Regulatory Elements (hg38, for more details, see https://www.biorxiv.org/content/10.1101/2022.12.21.520137v1.full)
| RSID | SNP Chromosome | SNP Start Position | SNP End Position | CCRE Chromosome | CCRE Start Position | CCRE End Position | CCRE Center Position | CCRE Distance | CCRE ID | CCRE Type | N | gRNA Sequence | gRNA Chromosome | gRNA Start | gRNA Strand | Distance 1 Matches | Distance 2 Matches | Distance 3 Matches | Distance 4 Matches | Cutting Efficiency | Specificity | Synthesis Sequence | Cutting Position | Low Specificity | Poly4N | Poly4T |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396163 | 396513 | 396338 | 97 | EH38D3802560 | dELS | 13870553 | GCCTTATCATGTGAAACCACNGG | chr6 | 396224 | + | 0 | 1 | 11 | 200 | 0.518349 | 0.406517 | GCCTTATCATGTGAAACCAC | 396241 | false | false | false |
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396163 | 396513 | 396338 | 2 | EH38D3802560 | dELS | 25167929 | CCNGGTTTAGCCATATGACGAAG | chr6 | 396346 | - | 0 | 2 | 23 | 206 | 0.535653 | 0.527418 | CTTCGTCATATGGCTAAACC | 396340 | false | false | false |
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396163 | 396513 | 396338 | 161 | EH38D3802560 | dELS | 25425708 | CCNGAGGAGTTTGGAGGCTGTAA | chr6 | 396505 | - | 0 | 0 | 35 | 439 | 0.457482 | 0.229627 | TTACAGCCTCCAAACTCCTC | 396499 | false | false | false |
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396163 | 396513 | 396338 | 175 | EH38D3802560 | dELS | 26199493 | AAGGGATTCCCTGAGGAGTTNGG | chr6 | 396496 | + | 0 | 2 | 31 | 419 | 0.347224 | 0.21894 | AAGGGATTCCCTGAGGAGTT | 396513 | false | false | false |
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396163 | 396513 | 396338 | 58 | EH38D3802560 | dELS | 26551885 | CCNTTATGATCCTCCATGAGTGT | chr6 | 396402 | - | 0 | 3 | 21 | 287 | 0.463915 | 0.257165 | ACACTCATGGAGGATCATAA | 396396 | false | false | false |
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396163 | 396513 | 396338 | 0 | EH38D3802560 | dELS | 27793549 | AAATTCCCCTGTGGTACTTTNGG | chr6 | 396321 | + | 0 | 1 | 28 | 349 | 0.265102 | 0.246199 | AAATTCCCCTGTGGTACTTT | 396338 | false | true | false |
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396163 | 396513 | 396338 | 156 | EH38D3802560 | dELS | 29964932 | CTTCGGCTGTCAGTCTAATANGG | chr6 | 396477 | + | 0 | 0 | 3 | 115 | 0.257611 | 0.561433 | CTTCGGCTGTCAGTCTAATA | 396494 | false | false | false |
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396163 | 396513 | 396338 | 157 | EH38D3802560 | dELS | 31455981 | TTCGGCTGTCAGTCTAATAANGG | chr6 | 396478 | + | 0 | 0 | 12 | 186 | 0.513525 | 0.40387 | TTCGGCTGTCAGTCTAATAA | 396495 | false | false | false |
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396163 | 396513 | 396338 | 12 | EH38D3802560 | dELS | 32334895 | CCNTATGACGAAGCTTTACATAA | chr6 | 396356 | - | 0 | 0 | 12 | 213 | 0.348292 | 0.523357 | TTATGTAAAGCTTCGTCATA | 396350 | false | false | false |
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396163 | 396513 | 396338 | 51 | EH38D3802560 | dELS | 35270196 | CCNTTGTCCTTTATGATCCTCCA | chr6 | 396395 | - | 0 | 1 | 37 | 555 | 0.616847 | 0.226077 | TGGAGGATCATAAAGGACAA | 396389 | false | false | false |
| rs12203592 | chr6 | 396320 | 396321 | chr6 | 396163 | 396513 | 396338 | 168 | EH38D3802560 | dELS | 6024526 | GTCTAATAAGGGATTCCCTGNGG | chr6 | 396489 | + | 0 | 0 | 13 | 175 | 0.693811 | 0.284919 | GTCTAATAAGGGATTCCCTG | 396506 | false | false | false |